=Paper=
{{Paper
|id=Vol-2030/HAICTA_2017_paper3
|storemode=property
|title=First Report of Toxoplasma gondii in the Woodcock (Scolopax rusticola): Preliminary Results
|pdfUrl=https://ceur-ws.org/Vol-2030/HAICTA_2017_paper3.pdf
|volume=Vol-2030
|authors=Konstantinos Moustakidis,Vangelis Economou,Chrysostomos Dovas,Isaia Symeonidou,Elias Papadopoulos,Margarita Papazahariadou
|dblpUrl=https://dblp.org/rec/conf/haicta/MoustakidisEDSP17
}}
==First Report of Toxoplasma gondii in the Woodcock (Scolopax rusticola): Preliminary Results==
https://ceur-ws.org/Vol-2030/HAICTA_2017_paper3.pdf
First Report of Toxoplasma gondii in the Woodcock
(Scolopax rusticola): Preliminary Results
Moustakidis Konstantinos1, Economou Vangelis2, Dovas Chrysostomos3,
Symeonidou Isaia4, Papadopoulos Elias5, Papazahariadou Margarita6.
1
Laboratory of Parasitology and Parasitic Diseases, School of Veterinary Medicine, Aristotle
University of Thessaloniki, Greece, email: moustakidisdogs@gmail.com.
2
Laboratory of Hygiene of Food of Animal Origin, School of Veterinary Medicine, Aristotle
University of Thessaloniki, Greece, email: boikonom@vet.auth.gr.
3
Diagnostic Laboratory, School of Veterinary Medicine, Faculty of Health Sciences, Aristotle
University of Thessaloniki, email: dovas@vet.auth.gr
4
Laboratory of Parasitology and Parasitic Diseases, School of Veterinary Medicine, Aristotle
University of Thessaloniki, Greece, email: isaia@vet.auth.gr.
5
Laboratory of Parasitology and Parasitic Diseases, School of Veterinary Medicine, Aristotle
University of Thessaloniki, Greece, email: eliaspap@vet.auth.gr.
6
Laboratory of Parasitology and Parasitic Diseases, School of Veterinary Medicine, Aristotle
University of Thessaloniki, Greece, email: ritap@vet.auth.gr.
Abstract. Toxoplasmosis is one of the most common zoonoses worldwide. It
is a systemic infection caused by the protozoan parasite Toxoplasma gondii.
Felids are the only definitive hosts of T. gondii with mammals, humans,
poultry, and wild birds serving as intermediate hosts. In this study, the
presence of T. gondii in woodcocks was investigated. Eighty-six woodcocks
were collected from the area of Macedonia and Mesolonghi and examined by
PCR for T. gondii. Four samples were tested positive and the prevalence rate
was 4.76%. Therefore, woodcocks carrying T. gondii tissue cysts can
contaminate animals and humans feeding on them. This is the first report of the
detection of T. gondii in woodcocks. Further study is needed to investigate the
isolation and genetic characterization of T. gondii in woodcocks in Greece in
order to elucidate the role of this bird in the transmission of T. gondii and to
safeguard public health.
Keywords: Toxoplasma gondii, protozoan, woodcock, Scolopax rusticola,
game meat, polymerase chain reaction.
1 Introduction
Toxoplasmosis is one of the most common zoonosis worldwide caused by the
protozoan parasite Toxoplasma gondii, which occurs in domestic and wild mammals,
humans, poultry, and wild birds also (Cabezón et al., 2011; Salant et al., 2013). This
protozoan has heteroxenous life cycle with the sexual development occurring only in
the intestine of felines, (definitive hosts) and asexual replication occurring
extraintestinally into the tissues (tissue cysts) in homeothermic vertebrate hosts,
20
(intermediate hosts) (Gennari et al., 2013; Halova et al., 2013; Sandström et al.,
2013). Cats or other members of the family Felidae may become infected with T.
gondii via predation on infected birds and rodents when feeding on food scraps
containing meat of livestock or by ingesting sporulated oocysts of the parasite from
the environment (Darwich et al., 2012; Molina-López et al., 2012).
Toxoplasmosis is of veterinary and medical importance, because it may cause
abortion or congenital disease and even death in its intermediate hosts (Darwich et
al., 2012; Huang et al., 2012). Concerning public health, the parasite causes an
asymptomatic infection in most healthy people; however, the infection can be fatal
for a fetus during pregnancy or for immuno-compromised individuals. In humans,
toxoplasmosis is a benign illness associated with mild clinical symptoms. However,
congenitally infected children can exhibit blindness and mental retardation. The
current global estimated incidence of congenital toxoplasmosis is 190,100 cases a
year in humans (Lopes et al., 2011; Huang et al., 2012; Matsuo et al., 2014). In
immuno-compromised individuals T. gondii infection is ranked as the leading cause
of death (Huang et al., 2012; Tian et al., 2012). Humans acquire T. gondii through the
consumption of undercooked meat containing tissue cysts or through the ingestion of
sporulated oocysts in soil and water, or on vegetables (Cabezón et al. 2011; Yu, L et
al., 2013). Still, oocysts have been found both in water and in soil samples around
human dwellings contaminating among others marine mammals and filter feeding
fish and bivalves (Sandström et al., 2013). A European multicenter case–control
study found that between 30% and 63% of T. gondii infections in humans could be
attributed to meat consumption (including cured meat) (Halova et al., 2013).
T. gondii infections are prevalent in many avian species, and can cause mortality
in some of them, including poultry, game and other species in the wild (Cabezón et
al., 2011). There are a lot of wild birds found infected with this parasite worldwide
such as, Tawny owls, Galapagos penguins, Flightless Cormorants, Ostrich ,griffon
vulture, Spanish Imperial eagle common buzzard, Egyptian vulture, cinereous
vulture, black kite ,bearded vulture, common kestrel ,short-toed snake-eagle,
Bonelli’s eagle and many others (Hove et al., 2005; Deem et al., 2010; Alvarado-
Esquivel et al., 2011; Cabezón et al., 2011; Gondim et al., 2011; Darwich et al.,
2012; Gennari et al., 2014). The importance of wild birds as intermediate hosts of T.
gondii lies on the predation of them by felines, the consumption of birds by humans
and the dissemination of the parasite to distant places through migration. In addition,
ground-feeding birds are considered sentinels for soil contamination with T. gondii
oocysts (Cabezón et al., 2011; Gennari et al., 2014). Among the ground-feeding
birds, the Eurasian woodcock (Scolopax rusticola) is a migratory bird that is of
importance since it is a highly-prized prey consumed in large numbers. Woodcocks
nest in Russia, Ukraine, Latvia and Finland, and migrate among other countries to
Greece from late October to mid-November, where they spend their winter (Legakis,
2008).
The information on toxoplasmosis in woodcocks among other food wild birds is
very useful for evaluating the risk it poses to public health. Because there is no data
on toxoplasmosis in woodcocks according to literature, the aim of this study was to
determine the prevalence of infection of the birds with T. gondii using polymerase
chain reaction.
21
2 Materials and Methods
2.1 Sample collection and DNA extraction
Eighty-six hunted woodcocks were collected from local hunters from the prefecture
of Macedonia (n=40) and the area of Mesolonghi (n=46), Greece. Samples were
collected from October 2014 to February 2015. The heads of the hunted birds were
transported to the Laboratory of Parasitology and kept at -30oC until examination.
For DNA analysis, the brain was aseptically removed and DNA extraction was
performed according to the phenol – ethanol protocol of Psifidi et al. (2010). In brief,
1 ml of lysis reagent SLB [10 mM Tris–HCl (PH=7.5), 1 mM EDTA, 50 mM NaCl,
0.2% SDS] and 1 mg of proteinase K were used to digest brain tissue. The lysate was
extracted twice with 1 ml of phenol:chloroform (1:1). The aqueous phase was
transferred and the DNA was precipitated at -20°C for 3 hours after the addition of
2.5 volumes of ethanol and 0.1 volume of sodium acetate 3 M (pH=5.2). The DNA
was recovered after centrifugation at 12,000 g for 20 min, the supernatant was
discarded and the DNA pellet was washed with 70% ethanol. After a final
centrifugation, the DNA pellet was dried and finally re-suspended in 100 µl elution
buffer (10 mM Tris–HCl, pH=8.0).
2.2 PCR analysis
Two primers based on Reischl et al. (2003), were modified (Table 1) so as to increase
amplification efficiency and sensitivity of detection. The target was a 529 bp
repetitive fragment (AF487550) of T. gondii, identified in the Toxoplasma genome
by Homan et al. (2000) in over 300 copies. PCR assays targeting the 529 bp repeat
are 10–100 fold more sensitive than the B1 marker (Su et al., 2010). Because of this
high sensitivity, the 529 bp fragment is a preferred marker for the detection of T.
gondii in human and animal tissues (Su and Dubey, 2009). The primer sequences
were evaluated in silico using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The
melting temperature (Tm) of the primers was calculated using the “OligoAnalyzer
3.1” software (http://eu.idtdna.com/calc/analyzer) developed by IDT (Integrated
DNA Technologies, Coralville, IA).
Table 1. Description of primers used for PCR detection.
Primer Sequence (5’-3’) Tm (oC)
Tox-9upAu TCTTGGAGGAGAGATATCAGGACTGTAG 65.7
Tox-11doAu AGCGTCGTCTCGTCTAGATCGCA 68.3
The PCR (25 µl) was comprised of 1x F-517 Optimized DyNAzymeTM EXT
Buffer Detergent-free [Composition: 50 mM Tris–HCl, 1.5 mM MgCl2, 15 mM
(NH4)2SO4; Thermo Fischer Scientific, Vantaa, Finland], 0.2 mM of each dNTP, 1.5
mM MgSO4 (New England Biolabs, Ipswich, MA), 3 U of HotStartTaq DNA
22
polymerase (Qiagen, Hilden, Germany), 0.2 µM of each primer and 2 µl of DNA
extract. Amplification was carried out in an automatic DNA thermal cycler (Perkin-
Elmer, California). The initial denaturation (15 min at 94oC) was followed by 45
cycles of amplification (denaturation at 95°C for 30 sec, annealing at 60°C for 30
sec, and extension at 72°C for 10 sec), ending with a final extension at 72°C for 3
min. Positive control samples to T. gondii generously provided by Dr J.P. Dubey
(ARS, USDA, Beltsville, USA) were included in all PCR analyses. PCR products
were examined by electrophoresis in a 2% agarose gel stained with ethidium bromide
and visualized under UV light (Fig. 1).
Fig. 1. PCR detection of T. gondii. Lane 1, 100-bp DNA ladder; lane 4, positive sample
(product size=170 bp).
3 Results and Discussion
In this survey, of the 86 examined birds, 4 of them were tested positive by PCR for T.
gondii (prevalence=4.76%). This is the first report of the occurrence of T. gondii
among the woodcock population. Three of the positive samples were collected from
Central Macedonia (7.5%) whereas the one positive sample from South Western
Greece (2.2%). Since no data are available in the literature the present results are
discussed relating to findings from other wild birds with similar habits. The
prevalence rate observed in our study is lower than the one reported by Mancianti et
al. (2013) (2.91%) who have investigated the occurrence of the parasite in wild
waterfowls from Italy. It should be noted that although 9 of the 103 birds sampled
were seropositive, only 3 out of 9 of the positive birds were tested positive by PCR.
Even lower prevalence was found by Huang et al. (2012) who among 178 wild birds
23
(pheasants and sparrows), only 4 (2.25%) were tested positive. Alvarado-Esquivel et
al (2011) also reported that in Mexico, 17 (2.6%) of the 653 pigeons were
seropositive, although viable T. gondii was isolated from only 1 of the 7 seropositive
pigeons, interestingly belonging to an atypical genotype. On the contrary, Zhang et
al. (2015) noticed that among 249 waterfowls from China, 7.2% were tested positive,
a rate that is higher than the one observed in the present study. Also, according to
Darwich et al. (2012), among wild birds from Spain, 6% was positive for T. gondii.
Information on the prevalence of contamination of wild birds is useful for
assessing the threat to public health and the oocyst environmental contamination
(Lopes et al., 2011). The results of several investigations show that T. gondii
infection is widespread among wild birds, with large variation among different
species, orders, geographical regions and feeding behaviour (Salant et al., 2009; Tian
et al., 2012; Gennari et al., 2014). The warm and humid climate of Central
Macedonia and Mesolonghi, Greece, favours the survival of T. gondii oocysts and the
transmission of the parasite. The main risk factors associated with wild birds carrying
T. gondii are age and feeding behaviour, with higher rates of contamination reported
in older animals and in species with a meat-based diet (Cabezón et al., 2011; Lopes,
et al., 2011). Specifically, birds dwelling in the forest floor, such as woodcocks, are
more prone to T. gondii contamination (Gennari et al., 2014). Woodcocks are
regarded omnivorous birds, feeding mainly on earthworms, adult insects and their
larvae (e.g. beetles, scissors and centipedes), spiders, slugs, slips, and plant material
such as grains, fruits, cereals (e.g., oats and corn), grasses and leaves (del Hoyo et al.,
1996). Contamination of woodcocks by feeding on insects cannot be ruled out since
it has been reported that T. gondii oocysts can survive up to 10 days in cockroaches,
whereas flies have been identified as vectors of the parasite (Graczyk et al., 2005).
Particularly during migration, woodcocks also feed on small freshwater bivalves,
molluscs and crustaceans (Johnsgard, 1981). Since molluscs may act as vectors for
the transmission of T. gondii to humans (Robertson, 2007), they can possibly
contaminate also the feeding woodcocks.
The role of woodcocks as intermediate hosts is rather interesting since woodcocks
are migratory birds, travelling to Greece from regions of Russia, Latvia and Finland
and passing through Ukraine. It is evident that the carriage of the parasite by
woodcocks and generally migratory birds can disseminate different types of the
parasite to quite distant areas (Gennari et al., 2014). Also, woodcock is a highly-
prized catch among hunters, because of its savoury meat and the remarkable ability
to evade catch. Annually, 3-4 million woodcocks are reported to be hunted in
Europe. (Ferrand & Gossmann, 2001). Undercooked or cured wild game meat can be
a potential source of infection for humans and other animals. Consumers of
woodcock meat should be aware of the possibility of T. gondii infection and should
be advised to handle meat properly (Karatepe et al., 2011; Lopes et al., 2011; Halova
et al., 2013; Matsuo et al., 2014). Further study is needed to investigate the isolation
and genetic characterization of T. gondii in woodcocks in Greece in order to
elucidate the role of this bird in the transmission of T. gondii and to safeguard public
health.
24
4 Conclusions
This study presents the first report of the occurrence of T. gondii among the
woodcock population. Woodcocks carrying T. gondii tissue cysts can contaminate
animals and humans feeding on them. More precisely the consumption of
undercooked woodcock meat can be a potential source of infection for humans. Still,
further investigation is needed so as to elucidate the role of this migratory bird in the
epizootiology of toxoplasmosis.
Acknowledgements. The authors would like to thank Theologos Papadopoulos for
his expert technical assistance.
References
1. Alvarado-Esquivel, C., Rajendran, C., Ferreira, L.R., Kwok, O.C., Choudhary, S.,
Alvarado-Esquivel, D., RodríguezPeña, S., Villena, I., Dubey, J.P. (2011).
Prevalence of Toxoplasma gondii infection in wild birds in Durango, Mexico.
Journal of Parasitology, 97(5), pp. 809-12.
2. Cabezón, O., García-Bocanegra, I., Molina-López, R., Marco, I., Blanco, J.M.,
Höfle, U., Margalida, A., Abach-Raich, E., Darwich, L., Echeverría, I., Obón, E.,
Hernández, M., Lavín, S., Dubey, J.P., Almería, S. (2011). Seropositivity and risk
factors associated with Toxoplasma gondii infection in wild birds from Spain.
PLoS One, 6(12), e29549.
3. Casartelli-Alves, L., Boechat, V.C., Macedo-Couto, R., Ferreira, L.C., Nicolau,
J.L., Neves, L.B. Millar, P.R., Vicente, R.T., Oliveira, R.V.C., Muniz, A.G.,
Bonna, I.C.F., Amendoeir, M.R.R. Silva, R.C., Langoni, H., Schubach, T.M.P.,
Menezes, R.C. (2014). Sensitivity and specificity of serological tests,
histopathology and immunohistochemistry for detection of Toxoplasma gondii
infection in domestic chickens. Veterinary Parasitology, 204(3-4), pp. 346-51.
4. Darwich, L., Cabezón, O., Echeverria, I., Pabón, M., Marco, I., Molina-López,
R., Alarcia-Alejos, O., López-Gatius, F., Lavín, S., Almería, S. (2012). Presence
of Toxoplasma gondii and Neospora caninum DNA in the brain of wild
birds.Veterinary Parasitology, 183(3-4), pp. 377-81.
5. Deem, S.L., Merkel, J., Ballweber, L., Vargas, F.H., Cruz, M.B., Parker, P.G.
(2010). Exposure to Toxoplasma gondii in Galapagos Penguins (Spheniscus
mendiculus) and Flightless Cormorants (Phalacrocorax harrisi) in the Galapagos
Islands, Ecuador. Journal of Wildlife Diseases, 46(3), pp. 1005-1011.
6. Del Hoyo, J., Elliott, A., Sargatal, J. (1996). Handbook of the Birds of the World,
vol. 3: Hoatzin to Auks. Barcelona: Lynx Edicions.
7. Gennari, S.M., Ogrzewalska, M., Soares, H.S., Saraiva, D.G., Pinter, A., Labruna,
M.B., Dubey, J.P. (2013). Occurrence of Toxoplasma gondii antibodies in birds
from the Atlantic Forest, state of São Paulo, Brazil. Veterinary Parasitology, 200
25
(1-2), pp. 193-7.
8. Gondim, L.S., Abe-Sandes, K., Uzêda, R.S., Silva, M.S., Santos, S.L., Mota,
R.A., Vilela, S.M., Gondim, L.F. (2010). Toxoplasma gondii and Neospora
caninum in sparrows (Passer domesticus) in the Northeast of Brazil. Veterinary
Parasitology, 168 (1-2), pp. 121-4.
9. Graczyk, T.K., Knight, R. Tamang, L. (2005). Mechanical transmission of human
protozoan parasites by insects. Clinical Microbiology Reviews, 18(1), pp. 128-
132.
10. Halova, D., Mulcahy, G., Rafter, P., Turc, L., Grant, T., de Waal, T. (2013).
Toxoplasma gondii in Ireland: Seroprevalence and novel molecular detection
method in sheep, pigs, deer and chickens. Zoonoses Public Health, 60(2), pp.
168-73.
11. Homan, W.L., Vercammen, M., De Braekeleer, J., Verschueren, H. (2000).
Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in
Toxoplasma gondii, and its use for diagnostic and quantitative PCR. International
Journal of Parasitology, 30(1), 69-75.
12. Hove, T., Mukaratirwa, S. (2005). Seroprevalence of Toxoplasma gondii in farm-
reared ostriches and wild game species from Zimbabwe. Acta Tropica, 94(1),
p.49-53.
13. Huang, S.Y., Cong, W., Zhou, P., Zhou, D.H., Wu, S.M., Xu, M.J., Zou, F.C.,
Song, H.Q., Zhu, X.Q. (2012). First report of genotyping of Toxoplasma gondii
isolates from wild birds in China. Journal of Parasitology, 98(3), pp. 681-2.
14. Karatepe, M., Kılıç, S., Karatepe, B., Babür, C. (2011). Prevalence of
Toxoplasma gondii antibodies in domestic (Columba livia domestica) and wild
(Columba livia livia) pigeons in Niğde region,Turkey. Türkiye Parazitoloji
Dergisi 35(1), pp.23-6.
15. Legakis, A. (2008). Study on the migratory birds in Greece and South Ukraine.
Final report (in Greek). http://users.uoa.gr/~alegakis/index_el_files/PDFfiles/
Teliki Anafora.pdf (accessed 15 May 2017).
16. Lopes, A.P., Sargo, R., Rodrigues, M., Cardoso, L. (2011). High seroprevalence
of antibodies to Toxoplasma gondii in wild animals from Portugal. Parasitology
Research, 108(5), pp. 1163-9.
17. Mancianti, F., Nardoni, S., Mugnaini, L., Poli, A. (2013). Toxoplasma gondii in
waterfowl: The first detection of this parasite in Anas crecca and Anas clypeata
from Italy. Journal of Parasitology, 99(3), pp. 561-563.
18. Matsuo, K., Kamai, R., Uetsu, H., Goto, H., Takashima, Y., Nagamune, K.
(2014). Seroprevalence of Toxoplasma gondii infection in cattle, horses, pigs and
chickens in Japan. Parasitology International, 63(4), pp. 638-9.
19. Molina-López, R., Cabezón, O., Pabón, M., Darwich, L., Obón, E., Lopez-Gatius,
F., Dubey, JP., Almería, S. (2012). High seroprevalence of Toxoplasma gondii
and Neospora caninum in the common raven (Corvus corax) in the Northeast of
Spain. Research in Veterinary Science, 93(1), pp. 300-2.
26
20. Psifidi, A, Dovas, C, and Banos, G. (2010). A comparison of six methods for
genomic DNA extraction suitable for PCR-based genotyping applications using
ovine milk samples. Molecular and Cellular Probes, 24 (2), pp. 93-98.
21. Quist, C.F., Dubey, J.P., Luttrell, M.P., Davidson, W.R. (1995). Toxoplasmosis
in wild turkeys: a case report and serologic survey. Journal of Wildlife Diseases.
31(2), pp. 255-258.
22. Reischl, U., Bretagne, S., Krüger, D., Ernault, P., Costa, J.-M. (2003).
Comparison of two DNA targets for the diagnosis of Toxoplasmosis by real-time
PCR using fluorescence resonance energy transfer hybridization probes. BMC
Infectious Diseases, 3, pp. 7.
23. Robertson, L.J. (2007). The potential for marine bivalve shellfish to act as
transmission vehicles for outbreaks of protozoan infections in humans: A review.
International Journal of Food Microbiology, 120(3), pp. 201-216.
24. Salant, H., Landau, D.Y., Baneth, G. (2009). A cross-sectional survey of
Toxoplasma gondii antibodies in Israeli pigeons. Veterinary Parasitology, 165 (1-
2), pp. 145-9.
25. Sandström, C.A., Buma, A.G., Hoye, B.J., Prop, J., van der Jeugd, H.,
Voslamber, B., Madsen, J., Loonen, M.J. (2013). Latitudinal variability in the
seroprevalence of antibodies against Toxoplasma gondii in non-migrant and
Arctic migratory geese. Veterinary Parasitology, 194(1), pp. 9-15.
26. Sedlak, K., Franti, I.L. (2000). High susceptibility of partridges (Perdix perdix) to
toxoplasmosis compared with other gallinaceous birds. Avian Pathology, 29(6),
pp. 563-9.
27. Su, C., Dubey, J.P. 2009. Toxoplasma gondii. In: Liu, D. editor. Molecular
Detection of Foodborne Pathogens. Boca Raton, Florida: CRC Press. pp. 741-
753.
28. Su, C., Shwab, E.K., Zhou, P., Zhu, X.Q., Dubey, J.P. (2010). Moving towards an
integrated approach to molecular detection and identification of Toxoplasma
gondii. Parasitology, 137(1), pp. 1-11.
29. Tian, Y.M., Dai, F.Y., Huang, S.Y., Deng, Z.H., Duan, G., Zhou, D.H., Yang,
J.F., Weng, Y.B., Zhu, X.Q., Zou, F.C. (2012). First report of Toxoplasma gondii
seroprevalence in peafowls in Yunnan Province, Southwestern China. Parasites &
Vectors, 19(5), p. 205.
30. Yu, L., Shen, J., Su, C., Sundermann, C.A. (2013). Genetic characterization of
Toxoplasma gondii in wildlife from Alabama, USA. Parasitological Research,
112(3), pp. 1333-6.
31. Zhang, F.-., Wang, H.-., Qin, S.-., Wang, Z.-., Lou, Z.-., Zhu, X.-., Liu, Q. (2015).
Molecular detection and genotypic characterization of Toxoplasma gondii in wild
waterfowls in Jilin Province, Northeastern China. Parasitology International,
64(6), pp. 576-578.
27