=Paper=
{{Paper
|id=Vol-2030/HAICTA_2017_paper58
|storemode=property
|title=Investigation of Polymorphisms in MC4R and GPX5 Genes in Greek Pigs
|pdfUrl=https://ceur-ws.org/Vol-2030/HAICTA_2017_paper58.pdf
|volume=Vol-2030
|authors=Maria Anastasiadou,Alexandros Theodoridis,Georgios Michailidis
|dblpUrl=https://dblp.org/rec/conf/haicta/AnastasiadouTM17
}}
==Investigation of Polymorphisms in MC4R and GPX5 Genes in Greek Pigs==
https://ceur-ws.org/Vol-2030/HAICTA_2017_paper58.pdf
Investigation of Polymorphisms in MC4R and GPX5
Genes in Greek Pigs
Maria Anastasiadou1, Alexandros Theodoridis2, Georgios Michailidis3
1
Animal Research Institute, Hellenic Agricultural Organization Demeter, Paralimni Giannitsa,
Greece
2
Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece
3
School of Agriculture, Department of Animal Production, Aristotle University of
Thessaloniki, Greece
Abstract. Recent studies have reported that gene polymorphisms in
melanocortin 4 receptor (MC4R) and glutathione peroxidase 5 (GPX5) genes
are associated with litter size in pig and can be used as genetic markers in gene
assisted selection programs for the improvement of reproductive performance.
The objective of this study was to investigate the existence of these
polymorphisms in pigs raised in Greece. One hundred pigs raised in Greece
were included in the study. DNA was extracted and genotyping was performed
using RFLP- PCR. For MC4R, genotype GG had a frequency of 0.25, GA 0.55
and AA 0.20, while the frequency of allele G was 0.52 and of A 0.48. For
GPX5, genotype AA had a frequency of 0.22, AB 0.48 and BB 0.30, with
frequencies of alleles A and B being 0.46 and 0.54, respectively. The
molecular results indicated that all genotypes of the two genes were present in
the investigated population.
Keywords: gene polymorphisms, pig, litter size, reproduction
1 Introduction
One of the most important economically traits in pig production is reproductive rate,
and especially litter size, as an increase in the number of pigs weaned per sow will
increase economic returns for pig producers with minimal additional inputs
(Rothschild, 1996). Therefore, the genetical improvement of litter size in swine is of
expanding interest for pig producers. However, most selection programmes, are
almost only based on phenotypical traits, which are laborious, expensive and
especially in pig production time consuming.
During the last years, advances in molecular techniques can now be used to
increase rate of response to selection and marker assisted selection (MAS), employed
in conjunction with traditional selection methods, has been in progress to increase
477
litter size in swine. It has been proposed that candidate gene analyses can be used to
identify individual genes responsible for traits of economic importance (Rothschild
and Soller, 1997).
The glutathione peroxidase 5 gene (GPX5) on SSC7 is located in a chromosomal
region in which several quantitative trait loci (QTL) for reproductive traits in swine,
such as uterine capacity, ovulation rate and litter size have been detected. Linkage
analyses of GPX5 showed that this gene is closely linked to the major
histocompatibility complex (MHC), which has been suggested to have an effect on
reproductive traits in swine (Vaiman et al. 1998; Buske et al. 2005).
The melanocortin 4 receptor (MC4R) gene codes for a G-protein-coupled receptor
and it was demonstrated to be important in the control of energy balance in humans
and rodents. Energy balance is maintained by controlling energy intake, i.e. feed
intake, and energy expenditure by physical activity and metabolism. The response of
the melanocortin 4 receptor to leptin signalling can thus be considered as a link
between feed intake and body weight and body composition (Marsh et al. 1999;
Wikberg et al. 2000). Consequently, MC4R is a strong candidate for growth and
body composition in pigs, as well as reproductive performance.
Therefore, the aim of the present study was to establish GPX5 and MC4R genes
allele and genotypes frequencies, in a Greek swine population.
2 Materials and Methods
Population description
The study was conducted in a large commercial pig farm in Greece. One hundred
pigs were included in the study.
Genotyping procedure
DNA was extracted from whole blood samples using the NucleoSpin Blood kit
(Macherey-Nagel, Germany) according to manufacturer’s instructions. The integrity
of the DNA samples was examined by electrophoresis through a 1.5% agarose gel.
For genotyping of the MC4R gene a 483 bp fragment was amplified by PCR using
the primer pair: 5′-ACAGTTAAGCGGGTTGGAAT-3′ and 5′-
CAGGGGATAGCAACAGATGA-3′. PCR amplification was performed using
approximately 300ng of genomic DNA as template, 200 nM primers each, 1 mM
dNTPs and 1 unit Taq DNA Polymerase Recombinant in 25 µl total volume reaction.
PCR conditions were 94°C for 3 min, 35 cycles of 94°C for 30 sec, 56°C for 30 sec,
72°C for 30 sec and a final extension period at 72°C for 10 min. PCR products were
digested using TaqI restriction enzyme and resolved by electrophoresis on 1.5%
agarose gels, visualised with ethidium bromide and imaged under UV illumination.
For genotyping of the GPX5 gene a 501 bp fragment was amplified by PCR using
the primer pair: 5′- TTCATGTAGAACTTATTTCTG -3′ and 5′-
TGACTTACCCATTCTTCAG-3′. PCR amplification was performed using
approximately 300ng of genomic DNA as template, 200 nM primers each, 1 mM
478
dNTPs and 1 unit Taq DNA Polymerase Recombinant in 25 µl total volume reaction.
PCR conditions were 94°C for 3 min, 35 cycles of 94°C for 30 sec, 51°C for 30 sec,
72°C for 30 sec and a final extension period at 72°C for 10 min. PCR products were
digested using Hinfl, restriction enzyme and resolved by electrophoresis on 1.5%
agarose gels, visualised with ethidium bromide and imaged under UV illumination.
Once genotypes were determined, allelic frequencies at each gene locus were
calculated by gene counting. Deviations from Hardy-Weinberg equilibrium were
examined for each locus using chi-squared tests.
3 Results
As illustrated in Figures 1 and 2 (representative of some samples), PCR amplification
of the MC4R and GPX5 genes was successful, using the conditions detailed in
materials and methods. Furthermore, RFLP-PCR analysis performed in the PCR
products, using the restriction enzymes for each SNP, as described in materials and
methods, revealed the genotype of each animal, for each gene locus (Figures 3 and 4,
representative of some animals, for each gene).
Fig. 1. PCR amplification of the MC4R gene locus.
Fig. 2. PCR amplification of the GPX5 gene locus.
479
Fig. 3. RFLP-PCR analysis for the MC4R gene polymorphism. PCR products were digested
with TaqI.
Fig. 4. RFLP-PCR analysis for the GPX5 gene polymorphism. PCR products were digested
with Hinfl.
Genotypic and allelic frequencies estimated for the 100 examined pigs, for the two
gene loci are presented in Table 1.
Table 1. Genotypic and allelic frequencies (%) in the two studied gene loci
Allele Genotypic Frequency (%) Allelic frequency (%)
Gene Locus
0 + 00 0+ ++ 0 +
MC4R G A 0.25 0.55 0.20 0.52 0.48
GPX5 A B 0.22 0.48 0.30 0.46 0.54
As illustrated in Table 1, for MC4R, genotype GG had a frequency of 0.25, GA
0.55 and AA 0.20, while the frequency of allele G was 0.52 and of A 0.48. For
GPX5, genotype AA had a frequency of 0.22, AB 0.48 and BB 0.30, with
frequencies of alleles A and B being 0.46 and 0.54, respectively. Both MC4R and
GPX5 gene loci were found to be in Hardy-Weinberg equilibrium in the studied
population.
480
4 Discussion
In the present study we investigated the genotypes of the MC4R and GPX5 gene
polymorphisms in pigs raised in Greece. Since these two single nucleotide
polymorphisms have been reportedly associated with reproductive traits such as litter
size it was considered important to determine whether the desired genotypes were
present in Greek pigs.
Allelic frequencies of the two investigated gene locus estimated in the present
study were similar to those reported by previous studies (Buske et al. 2006; Jokubka
et al. 2005). This suggests that the desired genotypes are present in Greek pigs, and
would be very interesting to perform association studies between these SNPs and
reproductive parameters. Therefore, further work is needed in order to confirm these
associations in pigs raised in Greece. Once confirmed, these SNPs could be
incorporated in a larger panel of markers to assist breeders in selecting pigs with
improved reproductive traits, such as litter size.
References
1. Rothschild, M.F., Jacobson, C., Vaske, D., Tuggle, C., Wang, L., Short, T.,
Eckardt, G., Sasaki, S., Vincent, A., McLaren, D., Southwood, O., Van der
Steen, H., Mileham, A., Plastow, G. (1996) The oestrogen receptor locus is
associated with a major gene influencing litter size in pigs. Genetics, 93, p.201-
205.
2. Rothschild, M.F. and Soller, M. (1997) Candidate gene analysis to detect traits
of economic importance in domestic livestock. Probe, 8, p.13-22.
3. Vaiman, M., Chardon, P., Rothschild, M. F. (1998) Porcine major
histocompatibility complex. Revue scientifique et technique (International
Office of Epizootics), 17, p. 95-107.
4. Buske, B., Sternstein, I., Reibmann, M., Reinecke, P., Brockmann, G. (2006)
Analysis of association of GPX5, FUT1 and ESR2 genotypes with litter size in
a commercial pig cross population. Arch. Tierz., Dummerstorf, 49, p.259-268.
5. Marsh, D.J., Hollopeter, G., Huszar, D., Laufer, R., Yagaloff, K.A., Fisher,
S.L., Burn, P., Palmiter, R.D. (1999) Response of melanocortin-4 receptor-
deficient mice to anorectic and orexigenic peptides. Nature Genetics, 21, p.
119-122.
6. Wikberg, J.E.S., Muceniece, R., Mandrika, I., Prusis, P., Lindblom, J., Post, C.,
Skottner, A. (2000) New aspects on the melanocortins and their receptors.
Pharmacol. Res., 42, p. 393-420.
7. Jokubka, R., Maak, S., Kerziene, S., Swalve, H.H. (2005) Association of a
melanocortin 4 receptor (MC4R) polymorphism with performance traits in
Lithuanian White pigs. Journal of Animal Breeding and Genetics, 123, p.17-22.
481